Skip to main content
SleepCited

Metabolic engineering of Escherichia coli for efficient production of L-5-hydroxytryptophan from glucose.

Zhen Zhang, Zichen Yu, Jinduo Wang, Yifa Yu, Lanxiao Li et al.
Other Microbial cell factories 2022 20 次引用
PubMed DOI CC-BY PDF
<\/script>\n
`; }, get iframeSnippet() { const domain = 'sleepcited.com'; const params = 'pmid\u003D36153615'; return ``; }, get activeSnippet() { return this.method === 'script' ? this.scriptSnippet : this.iframeSnippet; }, copySnippet() { navigator.clipboard.writeText(this.activeSnippet).then(() => { this.copied = true; setTimeout(() => { this.copied = false; }, 2000); }); } }" @keydown.escape.window="open = false" @click.outside="open = false">

Embed This Widget

Style



      
      
    

Widget powered by . Free, no account required.

Study Design

研究类型
laboratory / metabolic engineering study
干预措施
Metabolic engineering of Escherichia coli for efficient production of L-5-hydroxytryptophan from glucose. not applicable
对照组
Placebo
效应方向
Positive
偏倚风险
Low

Abstract

BACKGROUND: 5-hydroxytryptophan (5-HTP), the direct biosynthetic precursor of the neurotransmitter 5-hydroxytryptamine, has been shown to have unique efficacy in the treatment of a variety of disorders, including depression, insomnia, and chronic headaches, and is one of the most commercially valuable amino acid derivatives. However, microbial fermentation for 5-HTP production continues to face many challenges, including low titer/yield and the presence of the intermediate L-tryptophan (L-Trp), owing to the complexity and low activity of heterologous expression in prokaryotes. Therefore, there is a need to construct an efficient microbial cell factory for 5-HTP production. RESULTS: We describe the systematic modular engineering of wild-type Escherichia coli for the efficient fermentation of 5-HTP from glucose. First, a xylose-induced T7 RNA polymerase-PT7 promoter system was constructed to ensure the efficient expression of each key heterologous pathway in E. coli. Next, a new tryptophan hydroxylase mutant was used to construct an efficient tryptophan hydroxylation module, and the cofactor tetrahydrobiopterin synthesis and regeneration pathway was expressed in combination. The L-Trp synthesis module was constructed by modifying the key metabolic nodes of tryptophan biosynthesis, and the heterologous synthesis of 5-HTP was achieved. Finally, the NAD(P)H regeneration module was constructed by the moderate expression of the heterologous GDHesi pathway, which successfully reduced the surplus of the intermediate L-Trp. The final engineered strain HTP11 was able to produce 8.58 g/L 5-HTP in a 5-L bioreactor with a yield of 0.095 g/g glucose and a maximum real-time productivity of 0.48 g/L/h, the highest values reported by microbial fermentation. CONCLUSION: In this study, we demonstrate the successful design of a cell factory for high-level 5-HTP production, combined with simple processes that have potential for use in industrial applications in the future. Thus, this study provides a reference for the production of high-value amino acid derivatives using a systematic modular engineering strategy and a basis for an efficient engineered strain development of 5-HTP high-value derivatives.

Full Text

PDF
Loading PDF...

Figures

Biosynthetic pathway diagram for L-5-hydroxytryptophan production from glucose in engineered Escherichia coli. Key enzymatic steps including tryptophan hydroxylase and cofactor regeneration pathways are highlighted as targets for metabolic engineering.

Fig. 1

Biosynthetic pathway diagram for L-5-hydroxytryptophan production from glucose in engineered Escherichia coli. Key enzymatic steps including tryptophan hydroxylase and cofactor regeneration pathways are highlighted as targets for metabolic engineering.

diagram
Comparison of 5-HTP titers from different E. coli strain variants engineered with various combinations of pathway modifications. Iterative optimization of the biosynthetic route yielded progressively higher 5-HTP accumulation from glucose.

Fig. 2

Comparison of 5-HTP titers from different E. coli strain variants engineered with various combinations of pathway modifications. Iterative optimization of the biosynthetic route yielded progressively higher 5-HTP accumulation from glucose.

chart
Fed-batch fermentation profiles showing 5-HTP production, glucose consumption, and cell growth over time in the optimized E. coli strain. Production kinetics demonstrate the scalability of the engineered pathway for industrial 5-HTP biosynthesis.

Fig. 3

Fed-batch fermentation profiles showing 5-HTP production, glucose consumption, and cell growth over time in the optimized E. coli strain. Production kinetics demonstrate the scalability of the engineered pathway for industrial 5-HTP biosynthesis.

chart
Analysis of L-tryptophan intermediate accumulation and its relationship to 5-HTP yield in engineered E. coli strains. Minimizing tryptophan overflow is a critical factor in maximizing conversion efficiency to 5-HTP.

Fig. 4

Analysis of L-tryptophan intermediate accumulation and its relationship to 5-HTP yield in engineered E. coli strains. Minimizing tryptophan overflow is a critical factor in maximizing conversion efficiency to 5-HTP.

chart
Cofactor balance analysis showing tetrahydrobiopterin (BH4) or related cofactor levels in the 5-HTP-producing E. coli strains. Adequate cofactor supply is essential for tryptophan hydroxylase activity and efficient 5-HTP biosynthesis.

Fig. 5

Cofactor balance analysis showing tetrahydrobiopterin (BH4) or related cofactor levels in the 5-HTP-producing E. coli strains. Adequate cofactor supply is essential for tryptophan hydroxylase activity and efficient 5-HTP biosynthesis.

chart
Summary of metabolic flux distribution in the optimized E. coli strain producing 5-HTP from glucose. The engineered pathway channels carbon flux through the shikimate and tryptophan branches toward efficient hydroxytryptophan formation.

Fig. 6

Summary of metabolic flux distribution in the optimized E. coli strain producing 5-HTP from glucose. The engineered pathway channels carbon flux through the shikimate and tryptophan branches toward efficient hydroxytryptophan formation.

diagram

Tables

Table 1

PromotersSequence aStrength b
lacZ TTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT0.3
M1–12TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATTGAGCCCTTTTGGTGCGTCAGTCAGTTTAAACCAGGAAACAGCT0.1 ± 0.01
M1–30TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATTGAGCCTGAGGTGGCTTATTATTCGTTTAAACCAGGAAACAGCT0.7 ± 0.04
M1–46TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATTGAGCCTCTCGCCCCACCAATTCGGTTTAAACCAGGAAACAGCT1.5 ± 0.1
M1–37TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATTGAGCCACTGGCTCGTAATTTATTGTTTAAACCAGGAAACAGCT1.9 ± 0.12
M1–93TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATTGAGCCCGTATTGTTAGCATGTACGTTTAAACCAGGAAACAGCT4.0 ± 0.12

Table 2

HostHydroxylasesCofactorsCultivation modemedium typeTiter (g/L)Reference
E. coli Phenylalanine 4-hydroxylase form Chromobacterium violaceum with mutations of L101Y and W180FBH4Shake flask; Supplementation of 5 mM L-Trp-0.55Hara et al., 2013 [11]
E. coli Phenylalanine-4-hydroxylase from Xanthomonas campestris with a mutation of W179FMH4

Shake flask; Supplementation of

2 g/L L-Trp

M9 minimal medium1.1–1.2Lin et al.,. 2014 [16]
E. coli Aromatic amino acid hydroxylase from Cupriavidus taiwanensis with a mutation of W179FBH4Supplementation of 1 g/L L-TrpMineral medium0.55Mora-Villalobos et al., 2017 [44]
E. coli Aromatic amino acid hydroxylase from Cupriavidus taiwanensis with mutations of F197 L and E219CMH4Fed-batchMineral medium0.962Mora-Villalobos et al., 2018 [17]
E. coli Human TPH2 mutant with a deletion of first 145 N-terminal and 24 C-terminal aminoacids (TPH2, NΔ145/CΔ24)BH4Fed-batch; Glycerol as carbon sourceMineral medium5.1Wang et al., 2018 [12]
E. coli Truncated human TPH2 (NΔ145/CΔ24)BH4Shake flask; Glycerol as carbon sourceMineral medium1.61Xu et al., 2020 [43]
E. coli Truncated human TPH2 (NΔ145/CΔ24) with mutations of E2K, N97I and P99CBH4Fed-batch; Glucose as carbon sourceMineral medium8.58This study

Table 3

StrainsCharacteristicsSource
 E. coli DH5αHost for cloningLab stock
 E. coli K-12 w3110Wild type, starting strainLab stock
 HTP01 E. coli W3110, ∆tnaA, lacI::PxylF-T7RNAP, mlc::mlc*This study
 HTP02HTP01, yghX::Ptrc-mtrA-PTPS-SPRThis study
 HTP03HTP02, yjgX::PT7-PCD-DHPRThis study
 HTP04HTP03, pSTV-TMThis study
 HTP05HTP03, pSTV-TM1This study
 HTP06HTP03, pSTV-TM2This study
 HTP07HTP06, trpLE::Ptrc-trpEfbrThis study
 HTP08HTP07, yjiV::Ptrc-aroGfbrThis study
 HTP09HTP08, ycgH::Ptrc-serAfbrThis study
 HTP10HTP09, mbhA::PM1−12-gdhesiThis study
 HTP11HTP09, mbhA::PM1−30-gdhesiThis study
 HTP12HTP09, mbhA::PM1−46-gdhesiThis study
 HTP13HTP09, mbhA::PM1−37-gdhesiThis study
 HTP14HTP09, mbhA::PM1−93-gdhesiThis study
Plasmid
 pGRBgRNA expression vectorLab stock [45]
 pRed-cas9Cas9 expression vectorLab stock [45]
 pSTV28P15A ori, CmR, E.coli expression vectorLab stock
 pSTV-TMpSTV28, PT7-TMThis study
 pSTV-TM1pSTV28, PT7-TM1 (TME2K)This study
 pSTV-TM2pSTV28, PT7-TM2 (TME2K/N97I/P99C)This study

References

  1. Untitled
  2. Untitled
  3. Untitled
  4. Untitled
  5. Untitled
  6. Untitled
  7. Untitled
  8. Untitled
  9. Untitled
  10. Untitled
  11. Untitled
  12. Untitled
  13. Untitled
  14. Untitled
  15. Untitled
  16. Untitled
  17. Untitled
  18. Untitled
  19. Untitled
  20. Untitled
  21. Untitled
  22. Untitled
  23. Untitled
  24. Untitled
  25. Untitled
  26. Untitled
  27. Untitled
  28. Untitled
  29. Untitled
  30. Untitled
  31. Untitled
  32. Untitled
  33. Untitled
  34. Untitled
  35. Untitled
  36. Untitled
  37. Untitled
  38. Untitled
  39. Untitled
  40. Untitled
  41. Untitled
  42. Untitled
  43. Untitled
  44. Untitled
  45. Untitled
  46. Untitled

Used In Evidence Reviews

Similar Papers