Dietary supplementation with Lactium and L-theanine alleviates sleep disturbance in adults: a double-blind, randomized, placebo-controlled clinical study.
연구 설계
- 연구 유형
- RCT
- 표본 크기
- 40
- 대상 집단
- Adults experiencing sleep discomfort; 40 participants enrolled in double-blind RCT comparing LTC-022 (Lactium + L-theanine dietary supplement) to placebo; gut microbiome composition also assessed.
- 기간
- 8 weeks
- 중재
- Dietary supplementation with Lactium and L-theanine alleviates sleep disturbance in adults: a double-blind, randomized, placebo-controlled clinical study. None
- 대조군
- Placebo
- 일차 결과
- Sleep quality assessed by Pittsburgh Sleep Quality Index and Insomnia Severity Index; sleep diary parameters (TST, SOL, SE, WASO, bedtime)
- 효과 방향
- Positive
- 비뚤림 위험
- Moderate
초록
INTRODUCTION: The use of natural products for the treatment of sleep disturbances is increasing owing to the side effects and limitations of traditional sleep therapy. Moreover, recent studies have shown a significant correlation between sleep quality and gut microbiota composition. This study aimed to assess the impact of LTC-022, a commercially available dietary supplement containing Lactium and L-theanine, on enhancing sleep quality. METHODS: Forty participants experiencing sleep discomfort were enrolled in a double-blind randomized controlled trial, wherein they received LTC-022 or a placebo orally for 8 weeks. The effects of treatment on sleep quality were assessed using the Pittsburgh Sleep Quality Index and Insomnia Severity Index. To comprehensively evaluate changes in sleep patterns, various parameters were evaluated, including the time in bed (TIB), total sleep time (TST), sleep onset latency (SOL), sleep efficiency (SE), wake after sleep onset (WASO) counts, and bedtime. These parameters were derived from daily sleep logs recorded over the 8-week study period, categorized into weekdays and weekends. Stool samples were analyzed for microbiome composition. The V4 region of bacterial 16S rRNA genes was amplified using specific primers (515F and 806R) and targeted for analysis. Microbial diversity, including operational taxonomic units, the Shannon and Chao indices, the Firmicutes/Bacteroidetes (F/B) ratio, and the variety of bacterial taxa, was assessed. RESULTS: No significant differences were observed in sleep quality and insomnia scale characteristics between the two groups. In-depth analysis using sleep diaries showed that WASO counts after 8 weeks and bedtime after 4 weeks showed significant differences between the LTC-022 and control groups. In the LTC-022 group, significant differences were observed in the increase in TST, decrease in SOL, increase in SE, decrease in WASO counts, and earlier bedtime. Microbiome analysis revealed that the abundance of the genera Blautia and Ruminococcus increased in fecal samples from the LTC-022 group. CONCLUSION: These results suggest that continuous LTC-022 intake has a beneficial effect on maintaining sleep duration and an appropriate bedtime. Additionally, changes in the gut microbiota may be linked to changes in sleep patterns resulting from the consumption of Lactium and L-theanine. CLINICAL TRIAL REGISTRATION: https://cris.nih.go.kr/cris/search/detailSearch.do/22841, KCT0007750.
요약
It is suggested that continuous LTC-022 intake has a beneficial effect on maintaining sleep duration and an appropriate bedtime and changes in the gut microbiota may be linked to changes in sleep patterns resulting from the consumption of Lactium and L-theanine.
전문
Introduction
Sleep disturbances are a common health problem in the modern 24-h society (
Interestingly, 41% of Koreans report poor sleep quality due to the influence of various social, environmental, and genetic factors (
“Lactium” is a synthetic derivative of alpha-s1 casein hydrolysate containing the alpha-casozepine peptide, which is one of the main components of milk protein (
Research focusing on the correlation between sleep and the gut microbiota is increasing. Recent studies have revealed that the gut microbiota not only influences normal sleep but also impacts abnormal sleep patterns and durations, as evidenced by the increasing focus on the gut–brain axis (
The present study sought to evaluate the effect of a commercially available dietary supplement (tentatively named LTC-022), containing Lactium and L-theanine as its main ingredients, on improving sleep quality. Furthermore, this study aimed to explore changes in the gut microbiome resulting from the consumption of LTC-022.
Materials and methods
Study design and procedure
This was a single-center, double-blind, randomized, placebo-controlled clinical trial. Eligible participants were administered LTC-022 or a placebo daily for 8 weeks and visited the hospital four times (screening, allocation, baseline measurement, an interim visit at 4 weeks from the start of the intervention, and a close-out visit at 8 weeks after the intervention) for efficacy and safety assessments. The participants were instructed to orally ingest one packet (one tablet of Lactium and one tablet of L-theanine) per day with water 1 h before bedtime for 8 weeks. The placebo, having the same color and size as LTC-022, contained lactose and dextrin as the main ingredients, and it was ingested in the same manner. The trial was approved by the Institutional Review Board of Semyung University Oriental Medicine Hospital (number: SMJOH-2022-07) and retroactively registered in the Clinical Research Information Service (number: KCT0007750
Participants
This study, conducted between November 2022 and May 2023, involved adults aged 30–59 years who reported that they experienced sleep disturbances. The choice of the age group in our study was based on several considerations. While it is true that life events such as having young children or experiencing menopause can significantly affect sleep patterns, we aimed to focus on a broad adult population. In the case of the elderly, sleep problems may manifest differently due to aging. By selecting the age range of 30 to 59 years, we aimed to capture a diverse group of individuals who are likely to encounter various life events and stressors. To exclude individuals with severe sleep disturbances, the study only included individuals with a Pittsburgh Sleep Quality Index (PSQI) score of >5 points and an Insomnia Severity Index (ISI) score of ≥8 but ≤21 points. The eligibility criteria for the participants are presented in
Interventions
Participants received either LTC-022 or placebo supplementation for 8 weeks. The main ingredients of LTC-022 are Lactium and L-theanine; these two functional ingredients have been individually approved for use in maintaining sleep health and recognized by the Ministry of Food and Drug Safety in Korea (Lactium: No. 2020-2, L-theanine: No. 2011-11) (
Outcomes
The primary endpoint was sleep quality, as measured using the PSQI (
The secondary endpoint was insomnia symptoms, which were measured using the ISI (
DNA extraction and microbiome analysis
Stool samples were collected twice at baseline, prior to LTC-022 consumption and at 8 weeks following the completion of the intake period. Samples for microbiome analysis were collected using a specialized stool kit (NBG-1C; NobleBio Inc., Seoul, Korea). Genomic DNA was extracted using the Omega Mag-Bind DNA Prep Kit (Omega Bio-tek Inc., Norcross, GA, United States) according to the manufacturer’s instructions. Amplification of the V4 region of the bacterial 16S rRNA genes was performed using the primers 515F (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGCCAGCMGCCGCGGTAA) and 806R (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT). These primers were selected to specifically target the V4 region of bacterial 16S rRNA genes. Subsequently, the amplified DNA fragments were used for downstream microbiome analyses. The polymerase chain reaction (PCR) conditions were as follows: initial denaturation at 95°C for 3 min followed by 25 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, with a final extension phase at 72°C for 5 min. The PCR products were sequenced using an Illumina i-Seq 100 system (Illumina, Inc., San Diego, CA, United States) at the R&D Center of Chong Kun Dang Healthcare. The sequence data were subjected to clustering of operational taxonomic unit (OTU) representative sequences at 98% similarity using a pipeline developed in the CLC Genomics Workbench 22.0 (QIAGEN, Aarhus, Denmark) at the R&D Center of Chong Kun Dang Healthcare. Taxonomic richness was determined using the SILVA 115 database as reference (
Demographic data
Demographic information (sex and age), anthropometric measurements (body mass index), lifestyle factors (smoking and alcohol consumption status), and vital signs were included as covariates. Anthropometric variables were measured using digital scales, while all other data were collected using structured questionnaires.
Safety indices and compliance
The safety of the treatment was assessed based on alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels (hepatic function). Both safety indices were examined during the screening visit and at 8 weeks, after completion of the intervention. Compliance was calculated using the following formula: the number of experimental adjuvants actually used divided by the number of experimental adjuvants that should have been used during the study period. The use of experimental adjuvants was further assessed based on daily sleep diary entries.
Randomization
The randomization code was generated as four block sizes in a 1:1 ratio for the experimental and control groups by the sponsor or designated manager before the start of the study. Randomization was conducted by assigning sequential numbers to eligible participants based on the results of the screening test. The investigators and participants were blinded to the group allocation and the items consumed by the participants. During the study period, double-blinding of the investigators and participants was maintained. The paper containing information on group allocation was kept in a sealed envelope until unblinding. In the event of emergency unblinding, the unblinding envelope was to be provided to the investigator.
Statistical analysis
Two-sided statistical analyses were conducted, with the significance level set at 5%. In the full analysis set, the intent-to-treat approach was utilized to analyze the endpoints. In the event of discontinuation of observation and treatment, the cause was identified and analyzed using the last-observation-carried-forward method. The baseline demographic and clinical characteristics were summarized using descriptive statistics. Categorical variables are presented as numbers and percentages and were analyzed using the chi-square test. Continuous variables are expressed as mean ± standard deviation (SD) and were analyzed using two-sample
Results
The demographic characteristics of the 40 participants enrolled at the time of randomization are presented in
Differences in sleep quality and insomnia scale characteristics are shown in
The sleep monitoring results from the subjective sleep diary are presented in
To assess the improvement in gut microbiota clustering associated with the efficacy of sleep enhancement, we examined the changes in the microbiota before and after the intake of Lactium and L-theanine, which are known for their sleep-improving effects.
The alpha diversity of each group was evaluated using OTUs and the Shannon and Chao indices. The results showed no significant difference in the changes in richness represented by OTUs and the Shannon and Chao indices between the LTC-022 and control groups after the intervention (
All stool samples contained five phyla: Firmicutes, Bacteroidetes, Actinobacteria, and Proteobacteria (each had a relative abundance <1%) (
After the intervention, significant differences were observed in the abundance of specific microbes between the LTC-022 and control groups, namely,
Furthermore, the LTC-022 group showed an increase in the abundance of
In contrast, the control group showed an increase in the abundance of
Discussion
This study investigated the safety and efficacy of LTC-022 intake in 40 adults experiencing sleep discomfort. Participants were randomly assigned to double-blind and placebo groups for an 8-week intervention period. Questionnaire-based sleep indicators and intestinal microbes were analyzed. In this study, Lactium and L-theanine, the main components of LTC-022, improved sleep quality and insomnia symptoms. However, similar trends were observed in both groups, showing no difference between them. However, in the sleep analysis reflecting real-life sleep conditions, WASO counts decreased and bedtimes were earlier in the LTC-022 group than that in the control group. The variables that showed differences only in the LTC-022 group were the TST, SE, and SOL.
This randomized controlled trial was designed to assess the clinical efficacy of LTC-022, which comprises Lactium and L-theanine as the main ingredients, on sleep quality. PSQI and ISI scores were measured on a subjective symptom scale, showing progressive improvement with LTC-022 consumption. However, no significant differences in PSQI and ISI scores were observed between the LTC-022 and control groups. The lack of an apparent effect of Lactium may be attributed to the small sample size (
WASO counts decreased and bedtime shifted to an earlier time in the LTC-022 group after 4 and 8 weeks of intervention, respectively, compared to the control group. It was observed that these variables showed different changes between groups over time. In addition, a significant difference was observed in the LTC-022 group during weekdays, where TST increased, SE increased, WASO counts decreased, and bedtime was earlier at 8 weeks compared to that at 4 weeks. Sleep-related variables during weekdays were found to have more significant differences than those during weekend days, which typically mirrors weekday sleep patterns well (
The association between the microbiome and sleep has been established in numerous studies (
This study examined the correlation between sleep discomfort and the gut microbiome after the intake of Lactium and L-theanine, which are known to aid sleep. Variations were observed in the microbial changes, some aligning with previous research and others showing opposite trends. These findings suggest that the intake of Lactium and L-theanine may influence changes in microbial balance. Although further research and confirmation are necessary, these results support the correlation between sleep and the gut microbiome. However, the absence of significant changes in microbial alpha and beta diversity may be attributed to the non-implementation of certain dietary restrictions. Future studies may benefit from restricting the intake of dietary components that could influence the gut microbiome, such as probiotics, to assess changes in the gut microbiome more accurately.
A strength of this randomized, double-blind, placebo-controlled trial is the thorough investigation using a sleep diary, and the fact that it was conducted without any dropouts. Additionally, the study duration of 8 weeks was long enough to observe the improvement effect. Furthermore, measures were in place to ensure the safety of the participants and manage compliance, including a 5-day absence period after screening. This study evaluated the safety of the treatment by monitoring the levels of ALT and AST, which indicate liver function. Two safety indices were assessed during the examination visit and again 8 weeks after the intervention. Moreover, to overcome the uncertainty of treatment efficacy, the intervention period of this study was set to 8 weeks, at least twice as long as that used in previous studies (
One limitation of this study is the potential for recall bias associated with participants self-reporting their sleep time. Future studies should use objective measurements, such as a wearable activity tracker, to analyze sleep-related variables more accurately. Additionally, defining insomnia solely based on a PSQI score > 5 may have limited the accurate distinction between acute and chronic insomnia. Secondly, this study did not control for dietary intake and lifestyle factors. However, participants with milk allergies were excluded. Thirdly, the number of male participants were small (
Conclusion
This double-blind, randomized, placebo-controlled trial aimed to improve sleep quality in adults experiencing sleep discomfort using LTC-022 dietary supplements. Over an 8-week period, daily consumption of a dietary supplement (LTC-022) containing Lactium and L-theanine resulted in significant improvements in subjective sleep quantity and quality, including increased TST and SE, as well as reduced WASO counts and an earlier bedtime. Moreover, our results indicate that LTC-022 use for 8 weeks, compared to 4 weeks, is safe for individuals experiencing sleep disturbances and mild-to-moderate insomnia symptoms. Furthermore, we observed significant changes in the abundance of specific microbes, such as
Data availability statement
The original contributions presented in the study are included in the article/
Ethics statement
The studies involving humans were approved by Semyung University Oriental Medicine Hospital. The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study. Written informed consent was obtained from the individual(s) for the publication of any potentially identifiable images or data included in this article.
Author contributions
SLi: Writing – original draft, Writing – review & editing, Data curation. HK: Formal analysis, Data curation, Writing – review & editing. SLe: Conceptualization, Project administration, Supervision, Writing – review & editing. EK: Writing – original draft. J-HL: Formal analysis, Writing – review & editing. B-YK: Project administration, Writing – review & editing. S-MS: Conceptualization, Investigation, Writing – review & editing. YB: Conceptualization, Project administration, Writing – review & editing.
그림
Study protocol.
Effects of Lactium and L-theanine intake on microbiome composition. Presenting the numerical values of Operational Taxonomic Units (OTUs), Chao, and Shannon indices
표
Table 1
Participant characteristics.
| Characteristic | Total | LTC-022 ( | Control ( | |
|---|---|---|---|---|
|
| ||||
| Male | 2 (5.0) | 1 (5.0) | 1 (5.0) | 1.000 |
| Female | 38 (95.0) | 19 (95.0) | 19 (95.0) | |
| Age, yr. (SD) | 47.8 (6.8) | 48.2 (6.7) | 47.4 (7.1) | 0.176 |
| BMI, kg/m2 (SD) | 23.3 (2.5) | 23.3 (2.6) | 23.3 (2.4) | 0.954 |
|
| ||||
| Yes | 18 (45.0) | 10 (50.0) | 8 (40.0) | 0.751 |
| No | 22 (55.0) | 10 (50.0) | 12 (60.0) | |
|
| ||||
| Yes | 3 (7.5) | 2 (10.0) | 1 (5.0) | 1.000 |
| No | 37 (92.5) | 18 (90.0) | 19 (95.0) | |
|
| ||||
| AST, U/L (SD) | 20.60 (6.69) | 22.20 (7.56) | 19.00 (5.42) | 0.132 |
| ALT, U/L (SD) | 16.78 (8.14) | 18.45 (8.91) | 15.10 (7.12) | 0.197 |
Table 2
Differences in sleep status between LTC-022 and control groups Sleep quality was measure by Pittsburgh Sleep Quality Index, and Insomnia severity was by Insomnia Severity Index.
| Variables | LTC-022 | Control | p-interaction† | |
|---|---|---|---|---|
|
| ||||
| Baseline | 9.7 (2.43) | 10.8 (2.86) | 0.198 | 0.621 |
| Week 4 | 6.75 (2.34)* | 7.9 (2.83)* | 0.340 | |
| Week 8 | 6.55 (2.48)* | 6.95 (2.96)* | 0.847 | |
|
| ||||
| Baseline | 13.0 (4.30) | 14.2 (3.16) | 0.322 | 0.676 |
| Week 4 | 8.60 (3.78)* | 10.75 (4.61)* | 0.211 | |
| Week 8 | 7.25 (3.68)* | 9.4 (5.71)* | 0.282 | |
Table 3
Comparison of sleep diary data between the LTC-022 and control groups.
| Variables | Weekday | Weekend | ||||||
|---|---|---|---|---|---|---|---|---|
| LTC-022 | Control | p-interaction† | LTC-022 | Control | p-interaction† | |||
|
| ||||||||
| Baseline | 456.70 (57.70) | 455.35 (72.05) | 0.949 | 0.864 | 453.88 (57.50) | 453.33 (73.77) | 0.980 | 0.656 |
| Week 4 | 458.28 (47.64) | 450.09 (76.19) | 0.744 | 476.27 (74.51) | 474.72 (116.3) | 0.839 | ||
| Week 8 | 465.09 (55.82) | 457.17 (112.63) | 0.767 | 482.88 (65.18) | 462.29 (81.43) | 0.345 | ||
|
| ||||||||
| Baseline | 392.40 (58.04) | 400.39 (49.73) | 0.648 | 0.367 | 401.13 (52.49) | 412.38 (56.38) | 0.523 | 0.300 |
| Week 4 | 412.45 (45.41)* | 397.70 (53.69) | 0.143 | 428.94 (82.58) | 421.71 (86.08) | 0.444 | ||
| Week 8 | 419.75 (53.98)* | 407.86 (80.42) | 0.404 | 443.25 (65.26)* | 414.50 (59.31) | 0.123 | ||
|
| ||||||||
| Baseline | 64.30 (40.53) | 54.96 (59.80) | 0.570 | 0.355 | 52.75 (41.97) | 40.96 (52.29) | 0.441 | 0.359 |
| Week 4 | 45.83 (31.84)* | 52.39 (66.08) | 0.135 | 47.33 (41.30) | 53.01 (69.36) | 0.280 | ||
| Week 8 | 45.34 (41.67) | 49.30 (58.81) | 0.499 | 39.63 (34.78) | 47.79 (58.65) | 0.273 | ||
|
| ||||||||
| Baseline | 86.04 (8.58) | 88.93 (10.27) | 0.346 | 0.222 | 88.75 (8.46) | 91.72 (8.49) | 0.281 | 0.349 |
| Week 4 | 90.14 (6.17)* | 89.34 (10.32) | 0.124 | 89.91 (8.23) | 90.21 (10.17) | 0.528 | ||
| Week 8 | 90.50 (8.06)* | 90.56 (8.97) | 0.527 | 91.81 (6.51) | 90.65 (10.09) | 0.253 | ||
|
| ||||||||
| Baseline | 2.42 (1.49) | 1.66 (0.74) | 0.053 | 0.007 | 1.95 (0.97) | 1.89 (0.80) | 0.824 | 0.601 |
| Week 4 | 1.62 (1.68)* | 1.55 (0.71) | 0.119 | 1.50 (1.67) | 1.79 (0.94) | 0.499 | ||
| Week 8 | 1.31 (1.83)* | 1.63 (0.96) | 1.60 (2.55) | 1.53 (0.99) | 0.926 | |||
|
| ||||||||
| Baseline | 24:33 (59.66) | 24:22 (67.06) | 0.605 | 0.083 | 24:43 (53.01) | 24:28 (85.43) | 0.524 | 0.193 |
| Week 4 | 24:06 (48.32)* | 24:25 (66.72) | 24:20 (66.33) | 24:25 (84.43) | 0.503 | |||
| Week 8 | 24:01 (56.44)* | 24:25 (68.58) | 0.090 | 24:01 (62.02)* | 24:29 (66.34) | 0.055 | ||
Table 4
Microbial changes after the intervention in the LTC-022 and control groups.
| Genus | LTC-022 | Control | |
|---|---|---|---|
| Bifidobacterium | 5.13 (4.79) | 9.74 (6.62) | 0.041 |
| Prevotella | 13.23 (12.45) | 3.09 (6.53) | 0.027 |
| Erysipelatoclostridium | 0.18 (0.62) | 0.29 (0.41) | 0.024 |
| Megamonas | 1.96 (4.08) | 0.62 (2.50) | 0.018 |
Table 5
Microbial changes in the LTC-022 group before and after the intervention.
| LTC-022 | |||
|---|---|---|---|
| Genus | Baseline | Week 8 | |
|
| 0.17 (0.18) | 0.10 (0.06) | 0.046 |
|
| 6.59 (3.40) | 7.43 (2.94) | 0.031 |
|
| 0.47 (0.86) | 0.22 (0.55) | 0.027 |
|
| 0.02 (0.02) | 0.01 (0.01) | 0.045 |
|
| 0.27 (0.24) | 0.60 (0.79) | 0.027 |
|
| 0.02 (0.09) | 1.08 (2.44) | 0.037 |
|
| 2.01 (2.12) | 3.54 (3.37) | 0.003 |
|
| 1.73 (1.74) | 0.99 (0.77) | 0.017 |
Table 6
Microbial changes in the control group before and after the intervention.
| Control | |||
|---|---|---|---|
| Genus | Baseline | Week 8 | |
|
| 1.07 (0.81) | 1.50 (2.05) | 0.039 |
|
| 5.34 (3.39) | 9.71 (6.59) | 0.003 |
|
| 1.96 (1.88) | 2.93 (2.71) | 0.045 |
|
| 0.13 (0.17) | 0.29 (0.45) | 0.049 |
|
| 15.91 (8.56) | 11.95 (6.88) | 0.008 |
|
| 0.15 (0.13) | 0.26 (0.28) | 0.044 |
|
| 0.65 (1.06) | 0.31 (0.49) | 0.026 |
|
| 6.52 (9.91) | 3.09 (6.53) | 0.049 |
|
| 2.13 (2.36) | 2.97 (3.33) | 0.047 |
|
| 1.01 (1.13) | 0.70 (0.84) | 0.017 |
참고문헌 (36)
- The global problem of insufficient sleep and its serious public health implications Healthcare, 2018
- Sleep disturbances during the COVID-19 pandemic: a systematic review, meta-analysis, and meta-regression Sleep Med Rev, 2022
- The prevalence of depressive symptoms, anxiety symptoms and sleep disturbance in higher education students during the COVID-19 pandemic: a systematic review and meta-analysis Psychiatry Res, 2021
- Associations of sleep duration and quality with incident cardiovascular disease, cancer, and mortality: a prospective cohort study of 407,500 UK biobank participants Sleep Med, 2021
- Association of anxiety and depression in obstructive sleep apnea patients: a systematic review and meta-analysis Behav Sleep Med, 2020
- Sleep and quality of life in the Austrian population Acta Neurol Scand, 2000
- International study of the prevalence and factors associated with insomnia in the general population Sleep Med, 2021
- An international survey of sleeping problems in the general population Curr Med Res Opin, 2008
- Epidemiological overview of sleep disorders in the general population Sleep Med Res, 2011
- Factors associated with poor sleep quality in the Korean general population: providing information from the Korean version of the Pittsburgh sleep quality index J Affect Disord, 2020
- Untitled Useful health life statistics information to know
- The use of natural products for sleep: a common practice? Sleep Med, 2009
- Understanding the unmet needs in insomnia treatment: a systematic literature review of real-world evidence Int J Neurosci, 2023
- Characterization of α-casozepine, a tryptic peptide from bovine αs1-casein with benzodiazepine-like activity FASEB J, 2001
- A tryptic hydrolysate from bovine milk αS1-casein improves sleep in rats subjected to chronic mild stress Peptides, 2006
- The microbiota-gut-brain axis in sleep disorders Sleep Med Rev, 2022
- A double-blind, randomized, placebo-controlled crossover clinical study of the effects of alpha-s1 casein hydrolysate on sleep disturbance Nutrients, 2019
- Exploring the effect of Lactium™ and zizyphus complex on sleep quality: a double-blind, randomized placebo-controlled trial Nutrients, 2017
- Evaluation of perceived stress and sleep improvement with the dairy bioactive Lactium® Curr Dev Nutr, 2022
- L-theanine—a unique amino acid of green tea and its relaxation effect in humans Trends Food Sci Technol, 1999
- In search of a safe natural sleep aid J Am Coll Nutr, 2015
- Gut microbiome diversity is associated with sleep physiology in humans PLoS One, 2019
- 16S ribosomal RNA sequencing reveals a modulation of intestinal microbiome and immune response by dietary L-theanine supplementation in broiler chickens Poult Sci, 2019
- Effect of alpha-S1-casein tryptic hydrolysate and L-Theanine on poor sleep quality: a double blind, randomized placebo-controlled crossover trial Nutrients, 2022
- Untitled Food safety Korea, 2022
- The Pittsburgh sleep quality index: a new instrument for psychiatric practice and research Psychiatry Res, 1989
- Long-term nightly treatment with indiplon in adults with primary insomnia: results of a double-blind, placebo-controlled, 3-month study Sleep, 2007
- The consensus sleep diary: standardizing prospective sleep self-monitoring Sleep, 2012
- The SILVA ribosomal RNA gene database project: improved data processing and web-based tools Nucleic Acids Res, 2013
- The role and validity of actigraphy in sleep medicine: an update Sleep Med Rev, 2011
- Subjective sleep measurement: comparing sleep diary to questionnaire Nat Sci Sleep, 2019
- GABA and l-theanine mixture decreases sleep latency and improves NREM sleep Pharm Biol, 2019
- Recent progresses in gut microbiome mediates obstructive sleep apnea-induced cardiovascular diseases FASEB BioAdv, 2024
- Self-reported sleep quality is associated with gut microbiome composition in young, healthy individuals: a pilot study Sleep Med, 2020
- Food additives impair gut microbiota from healthy individuals and IBD patients in a colonic in vitro fermentation model Food Res Int, 2024
- How many days are needed for a reliable assessment by the sleep diary? Sleep Sci, 2020