Beta-Myrcene as a Sedative-Hypnotic Component from Lavender Essential Oil in DL-4-Chlorophenylalanine-Induced-Insomnia Mice.
Diseño del estudio
- Tipo de estudio
- animal experimental
- Población
- PCPA (DL-4-chlorophenylalanine)-induced insomnia mice treated with beta-myrcene for 1 or 7 days; network pharmacology predicted serotonergic pathway involvement
- Duración
- 1 weeks
- Intervención
- Beta-Myrcene as a Sedative-Hypnotic Component from Lavender Essential Oil in DL-4-Chlorophenylalanine-Induced-Insomnia Mice. None
- Comparador
- untreated PCPA-induced insomnia mice
- Resultado primario
- sleep duration, sleep latency, rate of falling asleep; GABA, 5-HT, and Glu neurotransmitter levels in PCPA-induced insomnia mice
- Dirección del efecto
- Positive
- Riesgo de sesgo
- Moderate
Resumen
With the increasing prevalence of insomnia-related diseases, the effective treatment of insomnia has become an important health research topic. Lavender (Lavandula angustifolia Mill.) essential oil (LEO) is a commonly used medicine for the treatment of insomnia and neurological disorders. However, neither the active components nor its sedative-hypnotic mechanism have been fully discovered. This study aimed to screen the main active terpenes and discover the possible mechanism of LEO through network pharmacology in the treatment of insomnia-related diseases, as well as to verify our hypothesis in insomnia mice. The results showed that, in LEO's 15 potential active ingredients, beta-myrcene had strong sedative-hypnotic effects through the serotonergic synaptic pathway according to the network pharmacological prediction. Further, PCPA(DL-4-chlorophenylalanine)-induced insomnia mice were treated with beta-myrcene for one day or seven days. The quiet state of insomnia mice was increased effectively, and the hypnotic effect was enhanced by anaobarbital sodium by prolonging sleep duration, decreasing sleep latency, and increasing the rate of falling asleep. Beta-myrcene reduced the damage to hypothalamic neuron cells induced by PCPA and increased neurotransmitter levels of GABA, 5-HT, and Glu in the serum and hypothalamus of insomnia mice. Meanwhile, beta-myrcene exerted an improvement in insomnia by upregulating relevant genes and protein expression in the serotonergic synaptic pathway. These results support the merit of the sedative-hypnotic activity of LEO. Beta-myrcene, a terpene in LEO, may be the main source of its sedative-hypnotic properties. It may serve as a good potential compound in future clinical studies on coping with insomnia.
TL;DR
Beta-myrcene, a terpene in LEO, may be the main source of its sedative–hypnotic properties and may serve as a good potential compound in future clinical studies on coping with insomnia.
Texto completo
1. Introduction
Insomnia is a sleep circumstance marked by recurring and ongoing challenges with falling and staying asleep, leading to inadequate sleep quality. Chronic insomnia may result in emotional issues like depression and anxiety, weaken the immune system, and increase the probability of developing hypertension, coronary heart disease, and depression, thus having a significant impact on overall health [
Lavender (
Currently, there are no studies reported about the individual terpenes of LEO and their effects on alleviating insomnia. This paper focused on examining the anti-insomnia activity of the active ingredients of LEO first, specifically the main terpenes and sesquiterpenes. The anti-insomnia ingredients and signaling pathways were screened by network pharmacology. Furthermore, since PCPA-treated ICR mice serve as an insomnia model [
2. Results
2.1. Selection of Targets and Network Analysis
A total of 167 LEO active gene targets in 15 terpenes were obtained from the Swiss Target Prediction database combined with the PharmMapper database. In addition, a total of 7189 disease-related targets were obtained from the GeneCards database, OMIM database, and TTD database search. These corresponding targets obtained from the screening of active components of LEO were imported into Venny2.1.0 with the relevant targets of sleep disorders, and 128 intersecting targets of the possible effects of LEO to improve sleep were obtained, and the results are shown in
2.2. GO and KEGG Enrichment Analyses
The 128 targets shared by LEO active ingredients and sleep regulation were imported into the DAVID6.8 online platform for GO function and KEGG pathway enrichment analysis. The results showed that a total of 261 BP, 41 CC, and 97 MF were obtained by GO functional analysis enrichment at
2.3. Screening the Results of the Construction of the “Active Ingredients-Potential Targets-Pathways” Network for LEO
A total of 14 signaling pathways with relevance to the two sleep disorders and the targets associated with these pathways were combined in the KEGG enrichment results. The network visualization was constructed with the selected 15 LEO active ingredients imported into Cytoscape 3.7.2 software with 76 nodes and 497 edges (
Based on the above network pharmacological results, beta-myrcene is the main component, with its content of LEO being 5.641%, which is higher than beta-caryophyllene [
2.4. Ameliorative Effects of Beta-Myrcene in Insomniac Mice
The overall mental state of the mice was fine, with shiny fur, and they exhibited normal daily activities before being modeled. They were alert and not easily startled by external stimuli. The mice showed signs of poor mental state, increased activities, heightened irritability, and susceptibility to being startled after administration of PCPA. There was also an increase in aggressive behaviors such as fighting and attacking. Next, food intake was significantly reduced, with body weight notably lower than the blank control group (
2.5. Effects of Beta-Myrcene on Autonomous Activity in Insomniac Mice
In a new environment, the spontaneous activity, exploratory behavior, and stress levels of experimental animals undergo changes. Open-field test is commonly used to assess these alterations and is widely employed to evaluate behavioral changes in animals, including the presence of anxiety or depressive behaviors [
2.6. Effects of Beta-Myrcene on Anaobarbital Sodium-Induced Sleep Test in Mice
Anaobarbital sodium-induced sleep test is a commonly used pharmacological method to detect sedative and hypnotic effects of drugs. Anaobarbital sodium is a central nervous depressant, which has sedative and hypnotic effects and can shorten the sleep latency and prolong sleep duration in laboratory animals. The sleep latency and sleep duration of experimental animals were explored by using subthreshold dose and suprathreshold dose [
The sleep latency and sleep duration of a suprathreshold dose (85 mg/kg) of anaobarbital sodium are shown in
2.7. Effects of Beta-Myrcene on the Hypothalamus of Insomnia Mice
As shown in
2.8. Effects of Beta-Myrcene on Neurotransmitter Levels in PCPA-Induced Insomnia Mice
Neurotransmitters play a crucial role in nerve signaling, and many sedative and hypnotic drugs exert pharmacological effects by altering the concentration of neurotransmitters [
2.9. Effects of Beta-Myrcene on the Levels of SOD and MDA in PCPA-Induced Insomnia Mice Sera
SOD is an important antioxidant enzyme in the body, which can be used to remove excess superoxide anion free radicals in the body. MDA is a substance produced by the peroxidation of lipids in the body. Therefore, the degree of damage to the body is often determined by measuring the content of SOD and MDA [
2.10. Effects of Beta-Myrcene on the 5-HT1AR, GABAARα1, GABAARγ2, and GluR1 mRNA Levels
Based on the above results, further research was conducted from the perspective of genes and RT-PCR was used to investigate the mRNA level of 5-HT1AR, GABAAR
2.11. Effects of Beta-Myrcene on the GAD65, GAD67, GABAARγ2, PKA, and 5-HT1A Proteins Levels
The expression levels of the proteins of GAD65, GAD67, GABAAR
In the seven days of administration, GAD65, GAD67, GABAAR
According to the above results, beta-myrcene, the active ingredient of LEO, can improve the symptoms of PCPA-induced insomnia in mice. Furthermore, mechanistic studies supported that beta-myrcene acted as a treatment for insomnia through the serotonergic synaptic pathway and indirectly mediated sleep by maintaining the balance of Glu and GABA, and the graphic abstract is shown in
3. Discussion
Lavender is a well-known aromatic plant in the world for treating insomnia. It is effective in regulating insomnia by modulating the serotonergic signaling pathway [
The hypothalamus plays a crucial role in regulating the sleep–wake cycle. During sleep, the hypothalamus deactivates the arousal system and stabilizes this behavioral state [
Neurotransmitters play a critically important role in information processing throughout the nervous system [
Additionally, oxidative stress is associated with insomnia, which can also regulate the sleep–wake circadian rhythm such as SOD and MDA [
To further investigate the effects of beta-myrcene on molecular mechanisms, we used
In summary, our study results demonstrated that beta-myrcene, one of the terpenes of LEO, exhibited significant anti-insomnia activity through network pharmacology. The in vivo effects included prolonging its sleep duration, decreasing sleep latency, and enhancing the rate of falling asleep and neurotransmitters. Furthermore, the mechanistic studies also suggested that beta-myrcene can exert therapeutic effects through the serotonergic synaptic signaling pathway. Meanwhile, beta-myrcene could participate in the balance of GABA and Glu to indirectly mediate sleep and play a sedative and hypnotic role. These findings provided the scientific basis for further experimental study on the effect of LEO on insomnia.
4. Materials and Methods
4.1. Animals
A total of 120 healthy male ICR mice weighing 18–22 g each, of SPF grade, were acquired from Henan SCXK Biotechnology Co., LTD (License No.: SCXK 2020-0005, Zhengzhou, Henan, China). The animals were fed adaptively in a sterile SPF laboratory for 3 days prior to the experiment. The room maintained a temperature of 25 °C, humidity of 55 ± 5%, and a photoperiod of 12 h light and 12 h darkness. The animals had free access to food and drink during this time. The animal research was approved by the Institutional Animal Care and Use Committee (IACUC) and adheres to institutional rules for animal welfare and experimental behavior.
4.2. Drugs and Drug Administration
Anaobarbital sodium was purchased from Shanghai Shangyao Xinya Pharm Co., H31021725, Shanghai, China. Diazepam was purchased from Shandong Sine Pharm Co., H37023039, Heze, China. Beta-myrcene was purchased from Chengdu Standard Sample Biotechnology Co., wkq22032504., Chengdu, China, and PCPA was purchased from Shanghai Aladdin Biochemical Technology Co., C2208165, Shanghai, China.
PCPA was suspended in mildly alkaline saline with 2% Tween 80 for abdomen injection [
4.3. Network Pharmacology Analysis Based on “Component-Target”
4.3.1. Acquisition of Active Ingredients of LEO Targets and Insomnia Disease Targets
In total, 15 major active ingredients in LEO were selected [
Then, the PharmMapper database (
Gene targets associated with sleep disorders were identified by searching the GeneCards database [
The active ingredient library of LEO was combined with the sleep diseases target library to locate prospective illness targets through the elimination of the intersection.
4.3.2. GO Analysis and KEGG Pathway Enrichment Analysis
The DAVID Bioinformatics Resources 6.8 database [
4.3.3. Construction of the “Active Ingredient-Potential Target-Pathway” Network of LEO
The 15 selected LEO active ingredients and their target proteins were combined with signaling pathways from KEGG enrichment analysis and related targets associated with the pathways. These data were imported into Cytoscape 3.7.2 software to construct a “component-target-pathway” network visualization. NetworkAnalyzer was applied to assess the primary active ingredients and key targets in the network through the parameters of Degree, Betweenness, and Closeness to discover possible action pathways.
4.4. Experimental Verification
4.4.1. Animal Model Preparation and Grouping
Once 120 ICR mice had undergone three days of adaptive feeding, they were assigned at random to the following groups: a blank control group, a PCPA group (350 mg/kg), a diazepam group (2.5 mg/kg), a beta-myrcene low-dose group (50 mg/kg), and a beta-myrcene high-dose group (200 mg/kg). A grand total of five groups were established. Within each group, 12 animals were subjected to single-dose observation and 12 animals were observed over a seven-day period of dosage. The blank group received an injection of physiological saline with Tween 80, while the other groups were injected with PCPA at a dosage of 350 mg/kg for three consecutive days to establish a model [
The detailed procedure of the animal study is shown in
4.4.2. Behavioral Observations in Mice
After the mice were grouped according to
4.4.3. Anaobarbital Sodium-Induced Sleep Test in Mice
At 30 min after the last dose, each group of mice was injected intraperitoneally with a subthreshold dose of 50 mg/kg of anaobarbital sodium. After the injection, the mice were placed on a warming pad and the sleep time was recorded. The number of mice in each group that fell asleep within 30 min was recorded using the disappearance of the turning reflex at 30 s after drug administration as an indicator of sleep onset, and the sleep rate of mice in each group was calculated. Sleep rate = number of mice falling asleep/total number of mice in each group [
The steps for the suprathreshold dose (85 mg/kg) were the same as above. Sleep latency and sleep duration of mice were recorded.
4.4.4. Sample Collection
At the end of the experiment, all mice described under
4.4.5. Histopathological Examinations (HE)
The hypothalamic lesions were histologically examined and identified by observing hematoxylin–eosin (H&E) staining. Whole brains of three mice from each group administered for seven days as described in
4.4.6. Neurotransmitter Content Was Detected by ELISA
The levels of neurotransmitter 5-HT in mice serum and hypothalamus were detected by mouse 5-HT ELISA Kit (Wuhan bioswamp Biotechnology Co., LTD, MU30036, Wuhan, China), and the levels of neurotransmitters GABA and Glu in mice hypothalamus were detected by mouse GABA ELISA Kit (Wuhan bioswamp Biotechnology Co., LTD, MU30278, Wuhan, China) and mouse GLU ELISA Kit (Shanghai EK-Bioscience Biotechnology Co., LTD, EK-
4.4.7. Antioxidant Enzyme Activity Measurements
The levels of SOD and MDA in the serum of mice administered for seven days were measured by using a superoxide dismutase (SOD) kit (Nanjing Jiancheng Bioengineering Institute Co., LTD, A001-3-2, Nanjing, China) and malondialdehyde (MDA) kit (Nanjing Jiancheng Bioengineering Institute Co., LTD, A003-1-1, Nanjing, China) to investigate the antioxidant effects of beta-myrcene on PCPA-induced insomnia in mice.
4.4.8. Real-Time Polymerase Chain Reaction (Rt-PCR)
Total RNA was extracted from the hypothalamus using Trizol reagent. The total RNA concentration was determined and then reverse-transcribed into cDNA. The cDNA was used as a template for quantitative real-time PCR analysis, which was performed using SYBR Green Realtime PCR Master Mix (TOYOBO Life Science Co., LTD, 238000, Shanghai, China). The data were analyzed using the BIO-Rad CFX Manager3.1 Software [
4.4.9. Western Blot Analysis
The hypothalamus tissue samples were lysed and homogenized in cold RIPA (Beijing Labgic Technology Co., LTD, BL504A, Beijing, China) and cocktail (Beijing Labgic Technology Co., LTD, BL612A, Beijing, China). The solution was then centrifuged at 12,000 rpm for 10 min at 4 ℃ and the protein concentration in the supernatant was determined using a commercial BCA assay kit (Thermo Fisher Scientific Co., LTD, #23225, St. Bend, OR, America). Protein samples (50 μg) were separated by adding them to a sodium dodecyl sulfate (10%) gel and transferring to a 0.22 µm polyvinylidene difluoride (PVDF) membrane. After incubation with 5% skimmed milk powder for 2 h at room temperature, the primary antibody was incubated overnight at 4 °C. Subsequently, TBST was used to wash the membrane and then it was incubated at room temperature for 1 h with horseradish peroxidase coupled with a secondary antibody. Rabbit anti-5HT1A (Affinit, AF5453, 1:1000), rabbit anti-GABA
4.4.10. Statistical Analyses
The data were analyzed using GraphPadPrism8 statistical software. Differences between the groups were examined using Student’s
The workflow of the integrated systems pharmacology approach employed herein is illustrated in
5. Conclusions
In this study, beta-myrcene was screened as the main active ingredient in LEO through network pharmacological analysis. The most classic serotonergic synapse signaling pathway was then selected for further investigation. Experimental research has shown that beta-myrcene can play a sedative and hypnotic role by mediating insomnia-related genes and target proteins, affecting serotonergic synaptic signaling pathway, increasing the quiet state of mice, reducing sleep latency, increasing sleep duration, and increasing the content of neurotransmitters in mice, as well as alleviating oxidative stress and neuronal cell damage caused by PCPA. Through the method of network pharmacology combined with experimental verification, this study elucidated the potential pharmacological mechanism underlying the use of LEO in the treatment of insomnia. The findings provide a reference for the future clinical application of LEO.
Abbreviations
Author Contributions
Conceptualization, L.C. and Y.L.; Methodology, L.C. and Y.L.; Software, L.C. and Y.L.; Validation, L.C., D.X. and N.Z., Formal Analysis, L.C.; Investigation, L.C.; Data Curation, L.C.; Writing—Original Draft Preparation, L.C.; Writing—Review and Editing, L.C. and L.S.; Supervision, L.S.; Project Administration, L.S. and Y.C.; Funding Acquisition, L.S. and J.Y. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
This study was approved by the Experimental Animal Ethics and Welfare Review of Hubei University (20230033, 15 June 2023).
Informed Consent Statement
Not applicable.
Data Availability Statement
Data will be made available upon request.
Conflicts of Interest
The authors declare no conflicts of interest.
Funding Statement
This project was supported by the Hubei Key Laboratory of Resources and Chemistry of Chinese Medicine (Lijuan Sun, KLRCCM2302) and Competitive research fund of Hubei University for Nationalities (Jin Yang, XN2314).
Footnotes
References
Associated Data
Data Availability Statement
Data will be made available upon request.
Figuras
The flow diagram illustrates network pharmacological analysis methods and validation strategies for in vivo and in vitro experiments. ELISA: enzyme-linked immunosorbent assay; SOD: superoxide dismutase; MDA: malondialdehyde; RT-PCR: real-time polymerase chain reaction; HE: histopathological examinations.
Tablas
Table 3
The primer sequence in
| Mouse |
|
|
|
| GABAARγ2 | F 5′ AGAATATGGCTATGAGTGTTTGGATGG 3′ | 27 | |
| R 5′ GGCTCCTGTTCGGCAATCTTC 3′ | 21 | ||
| GABAARα1 | F 5′ CCGTTCAGTGGTTGTAGCAGAAG 3′ | 23 | |
| R 5′ TTCAAGTGGAAGTGAGTCGTCATAAC 3′ | 26 | ||
| 5-HT1A | F 5′ TTCTATATTCCGCTGCTGCTCATG 3′ | 24 | |
| R 5′ CCACCTTCTTGACCGTCTTGC 3′ | 21 | ||
| GLUR1 | F 5′ ACAACTCAAGCGTCCAGAATAGAAC 3′ | 25 | |
| R 5′ CCTCATAGCGGTCATTGCCTTC 3′ | 22 | ||
| β-actin | F 5′ GAGGGAAATCGTGCGTGAC 3′ | 19 | |
| R 5′ GCTGGAAGGTGGACAGTGAG 3′ | 20 |
Table 4
| OMIM | Online Mendelian Inheritance in Man |
| TTD | Therapeutic Target Database |
| PCPA | DL-4-chlorophenylalanine |
| LEO | Lavender essential oil |
| GO | Gene Ontology |
| KEGG | Kyoto Encyclopedia of Genes and Genomes |
| 5-HT | 5-hydroxytryptamine |
| GABA | gamma-aminobutyric acid |
| PKA | protein kinase A |
| GLU | Glutamic acid |
| CC | cellular components |
| MF | molecular functions |
| BP | biological processes |
| HE | Histopathological examinations |
| ELISA | Enzyme-linked immunosorbent assay |
| SOD | Superoxide dismutase |
| MDA | Malondialdehyde |
| Rt-PCR | Real-time polymerase chain reaction |
| ECL | Electroche miluminescence |
| GAD67 | glutamate decarboxylase 67 |
| GAD65 | glutamate decarboxylase 65 |
| 5-HT1AR | 5-hydroxytryptamine receptor 1A |
| PVDF | polyvinylidene difluoride |
Referencias (46)
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled
- Untitled